View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4908_high_70 (Length: 241)
Name: NF4908_high_70
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4908_high_70 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 40650496 - 40650725
Alignment:
| Q |
1 |
gtgcaataacaatgagccaacaaaaagtttattggatgcatcaatgtcatatcaattccaacatcaaattcattctcagcnnnnnnnnnnaaatgaagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40650496 |
gtgcaataacaatgagccaacaaaaagtttattggatgcatcaatgtcatatcaattccaacatcaaattcattctcagctttttttta-aaatgaagtg |
40650594 |
T |
|
| Q |
101 |
agaaatatatatttaaatttaaaactaaacaaagagtcatgttgttcagatgcata--atgcaactttcagctcttcaaaatttagaatttgaacatttt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40650595 |
agaaatatatatttaaatttaaaactaaacaaagagtcacgttgttcagatgcatataatgcaactttcagctcttcaaaatttagaatttgaacatttt |
40650694 |
T |
|
| Q |
199 |
gaacctgtaattttactgcatatttaatttg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40650695 |
gaacctgtaattttactgcatatttaatttg |
40650725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University