View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4908_high_78 (Length: 228)
Name: NF4908_high_78
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4908_high_78 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 16 - 198
Target Start/End: Original strand, 51877713 - 51877895
Alignment:
| Q |
16 |
aatatattgaataacattatcttttacaagacctaattttgtacgatatacaattttatatatgaaaatgctaatgagttttctaattgcactccataag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| | ||| |||| |
|
|
| T |
51877713 |
aatatattgaataacattatcttttacaagatctaattttgtacgatatacaattttatatatggaaatgctaacgagttttctaattgtaatccttaag |
51877812 |
T |
 |
| Q |
116 |
gactttatatagtaagtttggtcaatataaacatgcagtccgtattcaagttgatttcttgaaatatgaccagagatcatata |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51877813 |
aactttatatagtaagtttggtcaatataaacatgcagtccgtattcaagttgatttcttgaaatatgcccagagatcatata |
51877895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University