View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4908_high_85 (Length: 203)

Name: NF4908_high_85
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4908_high_85
NF4908_high_85
[»] chr4 (1 HSPs)
chr4 (35-170)||(54913274-54913410)


Alignment Details
Target: chr4 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 35 - 170
Target Start/End: Complemental strand, 54913410 - 54913274
Alignment:
35 aaaatcatatacattatagaaataaaagataacaatctcatcaactttt-gcacacacataattatacccagaaatattcgaacattacccaaaataact 133  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||    
54913410 aaaatcatatacattatagaaataaaagataacaatctcatcaactttttgcacacacataattatacccagaaatcttcgaacattacccaaaataact 54913311  T
134 ctttcttttttgttatatataatgttttcgtagttta 170  Q
    |||||||||||||| ||||||||||||||||||||||    
54913310 ctttcttttttgttctatataatgttttcgtagttta 54913274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University