View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4908_low_31 (Length: 346)
Name: NF4908_low_31
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4908_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 1 - 324
Target Start/End: Complemental strand, 52832591 - 52832268
Alignment:
| Q |
1 |
cagaggaaactccgaattttattgtccactttccttacattgttaaacaaaggtcacatgtaacatcgccacacttgttacttcttttccctttttgcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| | |||| ||||||||||||||||||||||||||| |
|
|
| T |
52832591 |
cagaggaaactccgaattttattgtccactttccctacattgttaaacaaaggtcgcatgtaacaccaccacccttgttacttcttttccctttttgcac |
52832492 |
T |
|
| Q |
101 |
ccatttatgattgattatacacccttctcttgtagcagaaattaaagaacccaactcctccacattgtagtaacatacattttcggaatggcgaggaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52832491 |
ccatttatgattgattatacacccttctcttgtagcagaaattaaagaacccaactcctccacattgtagtaacatacattttcggaatggcgaggaaaa |
52832392 |
T |
|
| Q |
201 |
attattcaccatcttcatctgcattgcgttatgttcaacctcgttattacgcaaaaagacccaaacgttttgcatttctcattttccttttaatctctct |
300 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52832391 |
attattcatcatcttcatctgcattgcgttatgttcaacctcgttattacgcaaaaagacccaaacgttttgcatttctcattttccttttaatctctct |
52832292 |
T |
|
| Q |
301 |
tgcatggtttgtctatgatcgtca |
324 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
52832291 |
tgcatggtttgtctatgatcgtca |
52832268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University