View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4908_low_37 (Length: 325)

Name: NF4908_low_37
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4908_low_37
NF4908_low_37
[»] chr6 (2 HSPs)
chr6 (55-150)||(32192920-32193015)
chr6 (3-53)||(32194608-32194658)
[»] chr8 (1 HSPs)
chr8 (3-34)||(21549190-21549221)
[»] chr4 (1 HSPs)
chr4 (9-53)||(20361389-20361433)


Alignment Details
Target: chr6 (Bit Score: 84; Significance: 7e-40; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 55 - 150
Target Start/End: Complemental strand, 32193015 - 32192920
Alignment:
55 aaactgagtaatggacaatgttttgatgtggataattaaataaaataatgttaatgagaaatggtgattgcatcatcttttgtattcaaatattat 150  Q
    ||||||||||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
32193015 aaactgagtaatggagaatgttttgatgtggaaaattaaataaaataattttaatgagaaatggtgattgcatcatcttttgtattcaaatattat 32192920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 3 - 53
Target Start/End: Complemental strand, 32194658 - 32194608
Alignment:
3 tgaaattgaaattgatagatgcctacacttagatcgagagagagctcatta 53  Q
    |||||||||| ||||||||||||||||||||||||  ||||||||||||||    
32194658 tgaaattgaagttgatagatgcctacacttagatcacgagagagctcatta 32194608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 3 - 34
Target Start/End: Complemental strand, 21549221 - 21549190
Alignment:
3 tgaaattgaaattgatagatgcctacacttag 34  Q
    ||||||||||||||||||||||||||||||||    
21549221 tgaaattgaaattgatagatgcctacacttag 21549190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 9 - 53
Target Start/End: Complemental strand, 20361433 - 20361389
Alignment:
9 tgaaattgatagatgcctacacttagatcgagagagagctcatta 53  Q
    ||||||||||||||||||||||||||| ||  | |||||||||||    
20361433 tgaaattgatagatgcctacacttagaccgctacagagctcatta 20361389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University