View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4908_low_41 (Length: 312)
Name: NF4908_low_41
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4908_low_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 14 - 306
Target Start/End: Complemental strand, 10562195 - 10561903
Alignment:
| Q |
14 |
aagccatcagatgaatacttttggtttaaccgcccggccattgtcctcgacttacttcacttcactttgtttcaaaactcttttgagatcgcgtttttct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10562195 |
aagccatcagatgaatacttttggtttaaccgcccggccattgtcctcgacttacttcacttcactttgtttcagaactcttttgagatcgcgtttttct |
10562096 |
T |
|
| Q |
114 |
tttggatttgggtgagtgttttcactctaaatttcactttcaaatcaaagaaaatataattttcaattgtatcttatactcttacagacagggcgggact |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| | | |||||||||||||| |||||||| ||||||||||||||| |||||||||||| ||| || |||| |
|
|
| T |
10562095 |
tttggatttgggtgagtgttttcactctaaactcccctttcaaatcaaaggaaatataactttcaattgtatcttctactcttacagagaggacgagact |
10561996 |
T |
|
| Q |
214 |
tggctcaatggtaaggttgttgccgtgtcacatgttcgaattctaaaacagcctctccgcgtgtggtggtaaggctgtgtacatctgtgctgc |
306 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
10561995 |
tggcgcaatggtaagattgttgccgtgtcacatgttcgaattctaaatcagcctctccacgtgtggtggtaaggctgtgtacatctgtcctgc |
10561903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 83 - 140
Target Start/End: Original strand, 24125407 - 24125464
Alignment:
| Q |
83 |
tttcaaaactcttttgagatcgcgtttttcttttggatttgggtgagtgttttcactc |
140 |
Q |
| |
|
||||||||| ||||||||| |||||||||| || ||||||||| |||||||||||| |
|
|
| T |
24125407 |
tttcaaaacacttttgagagtacgtttttcttctgaatttgggtgtgtgttttcactc |
24125464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University