View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4908_low_42 (Length: 304)
Name: NF4908_low_42
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4908_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 20 - 293
Target Start/End: Original strand, 34675044 - 34675303
Alignment:
| Q |
20 |
cattaaacatcattagtaaggttgaaactagagtaattgaaaaaggcgcataatactaatcaaaagagaaatgacaaaatccaatttctttgtgcaattt |
119 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675044 |
cattaatcatcattagtaaggttgaaactacagtaattgaaaaaggcccataatactaatcaaaagagaaatgacaaaatccaatttctttgtgcaattt |
34675143 |
T |
 |
| Q |
120 |
tagtgatcaaaatcatgttctcttttgtattattctcctgatattagtatacaagttcatcaaattagatttagtaaacgtgtcgattctattttgcttg |
219 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34675144 |
tagtgatc--------------ttttgtattattctcttgatattagtatacaagttcatcaaattagatttagtaaaagtgtcgattctattttgcttg |
34675229 |
T |
 |
| Q |
220 |
gttcatatcatcacatgctctccattttgttattagcagatannnnnnnagacaaaatttagaatgtcaagtat |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
34675230 |
gttcatatcatcacatgctctccattttgttattagcagatatttttttagacaaaatttataatgtcaagtat |
34675303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University