View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4908_low_54 (Length: 267)
Name: NF4908_low_54
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4908_low_54 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 112 - 257
Target Start/End: Complemental strand, 9179874 - 9179729
Alignment:
| Q |
112 |
gtactgttcaccgtacttatacgataaacagtgcacaaatgtcgtattgttgacaattattatgttcaaattacttgcaaacaagaattttggaacggcc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9179874 |
gtactgttcaccgtacttatacgataaacagtgcacaaacgtcgtattgttgtcaattattatgttcaaattacttgcaaacaagaattttggaacggcc |
9179775 |
T |
|
| Q |
212 |
tattgcttatgataggcaacttttattttagattaggtgacctatg |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9179774 |
tattgcttatgataggcaacttttattttagattaggtgacctatg |
9179729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 53
Target Start/End: Complemental strand, 9179967 - 9179933
Alignment:
| Q |
19 |
gatttaacttaaattttgtgttacaaaatcaccgt |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9179967 |
gatttaacttaaattttgtgttacaaaatcaccgt |
9179933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University