View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4908_low_56 (Length: 261)
Name: NF4908_low_56
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4908_low_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 6 - 243
Target Start/End: Complemental strand, 36350672 - 36350435
Alignment:
| Q |
6 |
aggagcagagaaaggccaaaatagaagaaacaaacacaagtgaatcttggttgcagaaaacagacatacaaagaggaaaatttaacacaaaaatgattag |
105 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36350672 |
aggaacagaaaaaggccaaaatagaagaaacaaacacaagtgaatcttggttgcagaaaacagacatacaaagagaaaaatttaacacaaaaatgattag |
36350573 |
T |
|
| Q |
106 |
tctcttttggttaagttaactaatgtactctttcaaaagatctattaacatgaacataaatataaactcaatgttcctcaaaaagaagcaacaaagacat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36350572 |
tctcttttggttaagttaactaatgtactctttcaaaagatctattaacatgaacataaatataaactcaatgttcctcaaaaagaagcaacaaagacat |
36350473 |
T |
|
| Q |
206 |
ttctttgacttatcaaaaactgcaaacaaatagaaaaa |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36350472 |
ttctttgacttatcaaaaactgcaaacaaatagaaaaa |
36350435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University