View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4908_low_57 (Length: 259)
Name: NF4908_low_57
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4908_low_57 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 109 - 237
Target Start/End: Original strand, 32195338 - 32195466
Alignment:
| Q |
109 |
atttggactaataatttgactagtgtatacaagtacaatggtgactagcacatatgacaataagtccaggtggacaatgacgattttggatagtacaatc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32195338 |
atttggactaataatttgactagtgtatacaagtacaatggtgactagcacatatgacaataagtccaggtggacaatgacgattttggatagtacaatc |
32195437 |
T |
|
| Q |
209 |
ctcagctgtgttgcaacttgactccaact |
237 |
Q |
| |
|
||||||||||||||||||||| ||||||| |
|
|
| T |
32195438 |
ctcagctgtgttgcaacttgagtccaact |
32195466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 111 - 188
Target Start/End: Original strand, 32202467 - 32202544
Alignment:
| Q |
111 |
ttggactaataatttgactagtgtatacaagtacaatggtgactagcacatatgacaataagtccaggtggacaatga |
188 |
Q |
| |
|
||||||||| ||||| ||||||| ||||| | ||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
32202467 |
ttggactaacaattttactagtggatacatgaacaatggtggacagcacatatgacaataagtccagatggacaatga |
32202544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 50 - 111
Target Start/End: Original strand, 32195233 - 32195302
Alignment:
| Q |
50 |
atataatagatgatgcaatcaccctttctta--------ttatgtattattgacgtcaaacacaacaatt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||| |
|
|
| T |
32195233 |
atataatagatgatgcaatcaccctttcatattatcattttatgtattattgacgtgaaacacaacaatt |
32195302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University