View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4908_low_60 (Length: 256)
Name: NF4908_low_60
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4908_low_60 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 20082820 - 20082621
Alignment:
| Q |
1 |
acagaacagtaataaagaaaaattgaaaatgcatctttcttcctatagatatatgagatatcatggctgatggataaaactgtaaatggttgtgttttgt |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20082820 |
acagaacagtaataaagaaaaactgaaaatgcgtctttcttcctatagatatatgagatatcatggctgatggataaaactgtaaatggttgtgttttgt |
20082721 |
T |
|
| Q |
101 |
ttgacatgtgactaaagttcagctatgcttcgtttagtccatttaggttatggatgaaagacatgtggcaaaattatgcaagggttgagatgcccaatcc |
200 |
Q |
| |
|
||||| |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20082720 |
ttgacgtgtgacgaaagttcagctatacttcgtttagtccatttaggttatggatgaaagacacgtggcaaaattatgcaagcgttgagatgcccaatcc |
20082621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 239
Target Start/End: Complemental strand, 20082601 - 20082563
Alignment:
| Q |
201 |
ttacaaattgtgtattacctagtcaatcctattctgttg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20082601 |
ttacaaattgtgtattacctagtcaatcctatactgttg |
20082563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 133 - 191
Target Start/End: Complemental strand, 54448550 - 54448490
Alignment:
| Q |
133 |
tttagtccatttaggttatggatgaaagacatgtggcaaa--attatgcaagggttgagat |
191 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||| ||||| ||||||||||||| |
|
|
| T |
54448550 |
tttagtccatttaggtcatggatgaaagacatttggcaaaacattattcaagggttgagat |
54448490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 191
Target Start/End: Original strand, 6234031 - 6234084
Alignment:
| Q |
140 |
catttaggttatggatgaaagacatgtggcaaa--attatgcaagggttgagat |
191 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||| ||||| ||||||||||||| |
|
|
| T |
6234031 |
catttaggttatggatgaaagacacgtgacaaaacattatacaagggttgagat |
6234084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 116 - 173
Target Start/End: Original strand, 2665654 - 2665711
Alignment:
| Q |
116 |
agttcagctatgcttcgtttagtccatttaggttatggatgaaagacatgtggcaaaa |
173 |
Q |
| |
|
||||||| |||||| | ||||||||||||||| | | |||| |||||||||||||||| |
|
|
| T |
2665654 |
agttcaggtatgctccatttagtccatttagggtcttgatggaagacatgtggcaaaa |
2665711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 173
Target Start/End: Original strand, 34589371 - 34589411
Alignment:
| Q |
133 |
tttagtccatttaggttatggatgaaagacatgtggcaaaa |
173 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
34589371 |
tttagtccatttagggtatggatttaagacatgtggcaaaa |
34589411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 173
Target Start/End: Complemental strand, 45560668 - 45560628
Alignment:
| Q |
133 |
tttagtccatttaggttatggatgaaagacatgtggcaaaa |
173 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
45560668 |
tttagtccatttaggtcatggatgcgagacatgtggcaaaa |
45560628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 173
Target Start/End: Original strand, 34645581 - 34645621
Alignment:
| Q |
133 |
tttagtccatttaggttatggatgaaagacatgtggcaaaa |
173 |
Q |
| |
|
|||| |||||||||| |||||||| |||||||||||||||| |
|
|
| T |
34645581 |
tttactccatttagggtatggatgcaagacatgtggcaaaa |
34645621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University