View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4908_low_70 (Length: 248)
Name: NF4908_low_70
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4908_low_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 40650474 - 40650268
Alignment:
| Q |
1 |
ttttaatgaccttttaatagattctctctaaataaacaaaggaagaaaggtttaagtcgtcatttcttactgcttaagtgatggctgagaaatgttagga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40650474 |
ttttaatgaccttttaatagattctctctaaataaacaaaggaagaaaggtttaagtcgtcatttcttactgcttaagtgatgactgagaaatgttagga |
40650375 |
T |
 |
| Q |
101 |
tttagatgtattgtagtcacaatttccatgcattcactaagtcattcatttgtggctgttggatcaagatcagatgacccatatttcaagctcggcattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40650374 |
tttagatgtattgtagtcacaatttccatgcattcactaagtcatccatttgtggttgttgaatcaagatcagatgacccatatttcaagctcggcattt |
40650275 |
T |
 |
| Q |
201 |
tagagtt |
207 |
Q |
| |
|
||||||| |
|
|
| T |
40650274 |
tagagtt |
40650268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 194
Target Start/End: Complemental strand, 3706429 - 3706393
Alignment:
| Q |
158 |
gttggatcaagatcagatgacccatatttcaagctcg |
194 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
3706429 |
gttggatcaagatcagatgatccatgtttcaagctcg |
3706393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University