View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4908_low_76 (Length: 237)
Name: NF4908_low_76
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4908_low_76 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 61 - 165
Target Start/End: Original strand, 35387489 - 35387593
Alignment:
| Q |
61 |
tagtcttttccatgctaaatcccacctagatagaaactaaaaatgagaaaatacttgcttgttcacacaagcatttgaggacataattaagagatacgag |
160 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35387489 |
tagtcttttccatgctaaactccacctagatagaaactaaaaatgagaaaatacttgcttgctcacacaagcatttgaggacataattaagagataggag |
35387588 |
T |
 |
| Q |
161 |
tgaag |
165 |
Q |
| |
|
||||| |
|
|
| T |
35387589 |
tgaag |
35387593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University