View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4908_low_85 (Length: 224)
Name: NF4908_low_85
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4908_low_85 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 35141089 - 35141306
Alignment:
| Q |
1 |
ctcatcttcatcttcttcgttttcagatgaatgtctttgatccgattctgaagaaaacaaatacgcagcatgaaaaataaaaattaacaacgacgattac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35141089 |
ctcatcttcatcttcttcgttttcagatgaatgtctttgatccgattctgaagaaaacaaatacgcagcatgaaaaataaaaattaacaacgacgattac |
35141188 |
T |
 |
| Q |
101 |
tataacaaaacaaatcatacgaattcgtacgaaaatgcagaaaacagttacgtaccgagttcatcgttaggttgcgaactgttgtttatctcattctcag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35141189 |
tataacaaaacaaatcatacgaattcgtactaaaatgcagaaaacagttacgtaccgagttcatcgttaggttgcgaagtgttgtttatctcattctcag |
35141288 |
T |
 |
| Q |
201 |
actcttcatattcttcga |
218 |
Q |
| |
|
||||||||| ||||||| |
|
|
| T |
35141289 |
actcttcattctcttcga |
35141306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University