View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4908_low_89 (Length: 203)
Name: NF4908_low_89
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4908_low_89 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 35 - 170
Target Start/End: Complemental strand, 54913410 - 54913274
Alignment:
| Q |
35 |
aaaatcatatacattatagaaataaaagataacaatctcatcaactttt-gcacacacataattatacccagaaatattcgaacattacccaaaataact |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54913410 |
aaaatcatatacattatagaaataaaagataacaatctcatcaactttttgcacacacataattatacccagaaatcttcgaacattacccaaaataact |
54913311 |
T |
 |
| Q |
134 |
ctttcttttttgttatatataatgttttcgtagttta |
170 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54913310 |
ctttcttttttgttctatataatgttttcgtagttta |
54913274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University