View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4909-Insertion-10 (Length: 90)

Name: NF4909-Insertion-10
Description: NF4909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4909-Insertion-10
NF4909-Insertion-10
[»] chr1 (2 HSPs)
chr1 (29-62)||(48020758-48020791)
chr1 (57-90)||(48020803-48020836)


Alignment Details
Target: chr1 (Bit Score: 34; Significance: 0.0000000001; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 62
Target Start/End: Original strand, 48020758 - 48020791
Alignment:
29 tccttaatccttaataatcctatgttgttttgtt 62  Q
    ||||||||||||||||||||||||||||||||||    
48020758 tccttaatccttaataatcctatgttgttttgtt 48020791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 57 - 90
Target Start/End: Original strand, 48020803 - 48020836
Alignment:
57 tttgttcttacaagggtcaaatggtcaattgttg 90  Q
    ||||||||||||||||||||||||||||||||||    
48020803 tttgttcttacaagggtcaaatggtcaattgttg 48020836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University