View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4909-Insertion-11 (Length: 80)

Name: NF4909-Insertion-11
Description: NF4909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4909-Insertion-11
NF4909-Insertion-11
[»] chr2 (1 HSPs)
chr2 (8-80)||(45097059-45097131)
[»] chr6 (1 HSPs)
chr6 (8-44)||(11775891-11775927)


Alignment Details
Target: chr2 (Bit Score: 69; Significance: 1e-31; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 69; E-Value: 1e-31
Query Start/End: Original strand, 8 - 80
Target Start/End: Complemental strand, 45097131 - 45097059
Alignment:
8 ttcttggctttcaagtcttctaaggttgtcccttggccgttgattgaagaacagatgagagaattgtctctat 80  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
45097131 ttcttggctttcaagtcttctaaggttgtcccgtggccgttgattgaagaacagatgagagaattgtctctat 45097059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 33; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 8 - 44
Target Start/End: Complemental strand, 11775927 - 11775891
Alignment:
8 ttcttggctttcaagtcttctaaggttgtcccttggc 44  Q
    ||||| |||||||||||||||||||||||||||||||    
11775927 ttcttagctttcaagtcttctaaggttgtcccttggc 11775891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University