View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4909-Insertion-11 (Length: 80)
Name: NF4909-Insertion-11
Description: NF4909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4909-Insertion-11 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 69; Significance: 1e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 1e-31
Query Start/End: Original strand, 8 - 80
Target Start/End: Complemental strand, 45097131 - 45097059
Alignment:
| Q |
8 |
ttcttggctttcaagtcttctaaggttgtcccttggccgttgattgaagaacagatgagagaattgtctctat |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45097131 |
ttcttggctttcaagtcttctaaggttgtcccgtggccgttgattgaagaacagatgagagaattgtctctat |
45097059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 8 - 44
Target Start/End: Complemental strand, 11775927 - 11775891
Alignment:
| Q |
8 |
ttcttggctttcaagtcttctaaggttgtcccttggc |
44 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11775927 |
ttcttagctttcaagtcttctaaggttgtcccttggc |
11775891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University