View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4909-Insertion-5 (Length: 367)
Name: NF4909-Insertion-5
Description: NF4909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4909-Insertion-5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 18 - 367
Target Start/End: Original strand, 9533906 - 9534255
Alignment:
| Q |
18 |
tcaataaatactcaaacaattcacaacactccctcactcatttccattcttcagtttttcatcctttcaatcatcaccctcatggaaaacgtccctgtca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9533906 |
tcaataaatactcaaacaattcacaacactccctcactcatttccattcttcagtttttcatcctttcaatcatcgccctcatggaaaacgtccctgtca |
9534005 |
T |
 |
| Q |
118 |
atgagtcaagcccaaagaacaccacaccagccacttcccctcaacgcaccttggctgaacatgatcagccacctgttgagacaaacactgagggtgatac |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9534006 |
atgagtcaagcccaaacaacaccacaccagccacttcccctcaacgcaccttggctgaacatgatcagccacctgttgagacaaacactgagggtgatac |
9534105 |
T |
 |
| Q |
218 |
cgtcctgaaaacaccggaggaagtcctggccgaactaactgatgatgatgatgatttgatcccaaaaggtggtgatgagggtagcgaagaagacgatggg |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9534106 |
cgtcctgaaaacaccggaggaagtcctggccgaactaactgatgatgatgatgatttgatcccaaaaggtggtgatgagggtaacgaagaagacgatggg |
9534205 |
T |
 |
| Q |
318 |
gcttttaggacgatggttatcgccctaactgcggacggttcatctgttat |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9534206 |
gcttttaggacgatggttatcgccctaactgcggacggttcatctgttat |
9534255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University