View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4909_low_5 (Length: 260)
Name: NF4909_low_5
Description: NF4909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4909_low_5 |
 | |
|
| [»] scaffold0318 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0318 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: scaffold0318
Description:
Target: scaffold0318; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 108 - 250
Target Start/End: Original strand, 1846 - 1988
Alignment:
| Q |
108 |
acttgataggtgttaataagcctaaaatctcacccttctagacattaagaaaaaggttgcaatctcaattcagaccttatatcgaaagaagaagaaaaac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1846 |
acttgataggtgttaataagcctaaaatctcacccttcttgacattaagaaaaaggttgcaatctcaattcagaccttatatcgaaagaagaagaaaaac |
1945 |
T |
|
| Q |
208 |
ttgaatgaaattatatgcaactattttagattgaggccctttg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1946 |
ttgaatgaaattatatgcaactattttagattgagtccctttg |
1988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0318; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 19 - 121
Target Start/End: Original strand, 1726 - 1828
Alignment:
| Q |
19 |
gttccaacattatttgacaagttaaaagtccaatacacccttcgaatccaaagtaaaaataacactcttgaactctaatagccgcatccacttgataggt |
118 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
1726 |
gttccaacattgtttgataagttaaaagtccaatacaccctttgaatccaaagtaaaaataacactcttgaactctaatcgccgcatcaacttgataggt |
1825 |
T |
|
| Q |
119 |
gtt |
121 |
Q |
| |
|
||| |
|
|
| T |
1826 |
gtt |
1828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University