View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4910_high_17 (Length: 348)
Name: NF4910_high_17
Description: NF4910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4910_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 2 - 332
Target Start/End: Original strand, 34346436 - 34346764
Alignment:
| Q |
2 |
gatctagagcagtagcataggttattgttttttctagtcaaagggaagatttagcttttctaaccaaagcttcttttgatgcactttgttagtaatcaaa |
101 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34346436 |
gatctatagcagtagcttaggttattgttttttctagtcaaagggaagatttagcttttctaaccaaagcttcttttgatgcactttgttagtaatcaaa |
34346535 |
T |
 |
| Q |
102 |
gaagcatcattctcaaaattttagattgtaatctccatgattgttcatgattgggatttggttttgcgtgacaaaaggaaatccaatatgataaaaaatg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34346536 |
gaagcatcattctcaaaattttagattgtaatctccatgattgttcatgattgggatttggttttgcgtgacaaaaggaaatccaatatgatacaaaatg |
34346635 |
T |
 |
| Q |
202 |
aagaaggnnnnnnnnnnncagcttttataaagttgaattaacccccaaaaatgcaatacattgtttaacataacgcattttgctttaacaaacatggatc |
301 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34346636 |
aagaagg--aaaaaaaaacagcttttataaagttgaattaacccccaaaaatgcaatacattgtttaacataacgcattttgctttaacaaacatggatc |
34346733 |
T |
 |
| Q |
302 |
cggctatcaattcactttatagtgtaaaatg |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34346734 |
cggctatcaattcactttatagtgtaaaatg |
34346764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University