View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4910_high_22 (Length: 323)
Name: NF4910_high_22
Description: NF4910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4910_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 14 - 73
Target Start/End: Original strand, 20519549 - 20519608
Alignment:
| Q |
14 |
gaagaaaaaaggaatttttgataagaataaattacctacaattcgtcaagggtaatgtag |
73 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20519549 |
gaagaaaaaaggaattttttataagaataaattacctacaattcgtcaaggataatgtag |
20519608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University