View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4910_high_27 (Length: 305)
Name: NF4910_high_27
Description: NF4910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4910_high_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 2 - 92
Target Start/End: Original strand, 13649346 - 13649435
Alignment:
| Q |
2 |
gaggaggagcagagacttctgatcgacatcattctttgtaaaatcgaaagatttggtaacacaaaggggataagccaagattcctggtcga |
92 |
Q |
| |
|
|||||| ||| |||||||||||| |||| |||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13649346 |
gaggagaagctgagacttctgattgacaccattctttgtgaaatc-aaagatttggtaacacaaaggggataagccaagattcccggtcga |
13649435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University