View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4910_high_38 (Length: 248)
Name: NF4910_high_38
Description: NF4910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4910_high_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 15783698 - 15783933
Alignment:
| Q |
1 |
ctaactcatataatctcttttctaccgatcaaagatgctttcaggacaacccttctttcaaagagatgggttcaattgtgccactcactccccgttctcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
15783698 |
ctaactcatataatctcttttctaccgatcaaagatgctttcaggacaacccttctttcaaagagatgggttctattgtgccgctcactccccgttctcc |
15783797 |
T |
 |
| Q |
101 |
acatcaacgatgatggcgtgaaaaatgaaaaggacttgattcagtttcgtcaaatgttggatgccgttatgttttccccacgctctcaggaccgtaccct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15783798 |
acatcaacgatgatggcgtgaaaaatgaaaaggacttgattcagttccgtcaaatgttggatgccgttatgttttccccacgctctcaggacagtaccca |
15783897 |
T |
 |
| Q |
201 |
caaatcttttaaactcacgtgttgttcaatcctctg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
15783898 |
caaatcttttaaactcacgtgttgttcaatcctctg |
15783933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 19970640 - 19970455
Alignment:
| Q |
1 |
ctaactcatataatctcttttctaccgatcaaagatgctttcaggacaacccttctttcaaagagatgggttcaattgtgccactcactccccgttctcc |
100 |
Q |
| |
|
|||||||| || |||||||||| || |||| ||| |||||||| || ||| | ||||| |||| ||||| ||||||| |||||||||| |||||| |
|
|
| T |
19970640 |
ctaactcacattctctcttttcttccaatcagagacgctttcagaaccaccgtgctttccaagacgtgggtctcattgtgctactcactcccgattctcc |
19970541 |
T |
 |
| Q |
101 |
acatcaacgatgatggcgtgaaaaatgaaaaggacttgattcagtttcgtcaaatgttggatgccgttatgttttccccacgctct |
186 |
Q |
| |
|
|| || || || | | |||||| |||| |||||| ||||||||| | |||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
19970540 |
acttcgacaataaagacgtgaacaatgtaaaggaacagattcagttccatcaaatgttgaatgccgttatgttctccccacgctct |
19970455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University