View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4910_high_41 (Length: 240)
Name: NF4910_high_41
Description: NF4910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4910_high_41 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 26126760 - 26126539
Alignment:
| Q |
19 |
cttttagcattagtacagaaaggtttgtaaccttttagcgtttcctctcaaaactgaaacataagtatattccaaattcattactcattaatcattgtct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26126760 |
cttttagcattagtacagaaaggtttgtaaccttttggcgtttcctctcaaaactgaaacataagtatattccaaattcattactcattaatcattgtct |
26126661 |
T |
 |
| Q |
119 |
tcaaattactcgtcttgtcaccttccggatgcatcttctccctcagttaaaatccttgctgccgtcacacaactatccaaaactcagaatcgatgtgaga |
218 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
26126660 |
tcaaattactcgtctcgtcaccttccggatgcatcttctccctcagttaaaatccttgctgccgttacacaactatccaaaactcaaaatcgatgtgaga |
26126561 |
T |
 |
| Q |
219 |
tatctagaagtgggaaaaattt |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26126560 |
tatctagaagtgggaaaaattt |
26126539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 40 - 96
Target Start/End: Complemental strand, 45512893 - 45512837
Alignment:
| Q |
40 |
ggtttgtaaccttttagcgtttcctctcaaaactgaaacataagtatattccaaatt |
96 |
Q |
| |
|
|||||||||| |||| || || |||||||||||||||||||| || |||||| |||| |
|
|
| T |
45512893 |
ggtttgtaacattttggcattccctctcaaaactgaaacataggtgtattcctaatt |
45512837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University