View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4910_high_48 (Length: 212)
Name: NF4910_high_48
Description: NF4910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4910_high_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 14 - 195
Target Start/End: Original strand, 48020562 - 48020743
Alignment:
| Q |
14 |
gagcagagaataaaaagaaggtgagtgtactattttctagagagagaaagagtggaaatgatgaggaagttggcaggaacgttgtgactataaggagatg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48020562 |
gagcagagaataaaaagaaggtgagtgtactattttctagagagagaaagagtggaaatgatgaggaagttggcaggaacgttgtgactataaggagatg |
48020661 |
T |
 |
| Q |
114 |
ttttttgcaaatgagaaatgtgtcattatggtttgtttggttggtactcctaattccaatactcccactacttctttgtttt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48020662 |
ttttttgcaaatgagaaatgtgtcattatggtttgtttggttggtactcctaattccaatactaccactacttctttgtttt |
48020743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University