View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4910_low_39 (Length: 251)
Name: NF4910_low_39
Description: NF4910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4910_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 26126559 - 26126311
Alignment:
| Q |
1 |
atctagaagtgggaaaaatttaacaaatatccaaaacttgttcagtgttggctcttttttgttgccannnnnnn-gttaccaatcagtgggggtgactag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
26126559 |
atctagaagtgggaaaaatttaacaaatatccaaaacttgttcagtgttggctcttttttgttgccattttttttgttaccaatcagtgggggtaactag |
26126460 |
T |
 |
| Q |
100 |
gtttg---------caaggaagccccttcctccaccttatttattgccagttttccatggggtaccgctaagttccctcatccagtcatctcagtaaaaa |
190 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26126459 |
gtttgatgcatatgcaagggagccccttcctccaccttatttattgccagttttccacggggtgccgctaagttccctcatccagtcatcccagtaaaaa |
26126360 |
T |
 |
| Q |
191 |
gattttatatttttaggttagaagaaagatttggagtaggaaatatatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26126359 |
gattttatatttttaggttagaagaaagatttggagtaggaaatatatt |
26126311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University