View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4910_low_40 (Length: 251)
Name: NF4910_low_40
Description: NF4910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4910_low_40 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 13 - 251
Target Start/End: Complemental strand, 2624625 - 2624387
Alignment:
| Q |
13 |
aatataaaagatcacaattcaattgcgacaaatatctatatagaaaaaattgctacctgtgattctatcgtatacatcagccgcagattcaccatttgga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2624625 |
aatataaaagatcacaattcaattgcgacaaatatctatatagaaaaaattgctacctgtgattctatcgtatacatcagccgcagattcaccatttgga |
2624526 |
T |
|
| Q |
113 |
aatcggtaaaagaaacgaccataaagatggcgttgcgctttttcaactttcatcaactctctattttgaaaattcccttacataacataaatcacaaaga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2624525 |
aatcggtaaaagaaacgaccataaagatggcgttgcgctttttcaactttcatcaactctctattttgaaaattcccttacataacataaatcacaaaga |
2624426 |
T |
|
| Q |
213 |
aacaataaataaatttgagaacataccaatatacaagac |
251 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2624425 |
aacaataaataaatttgagaacatatcaatatacaagac |
2624387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University