View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4910_low_48 (Length: 233)
Name: NF4910_low_48
Description: NF4910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4910_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 40111924 - 40112139
Alignment:
| Q |
1 |
tgttgggcggggagaatccaccttatgtgccctatatgttttcgaacgagattagttattgttaaacggtggtggaaacttctaaccaatataatggtnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40111924 |
tgttgggcggggagaatccaccttatgtgccctatatgttttcgacggagattagttattgttaaacggcggtggaaacttctaaccaatataatggtaa |
40112023 |
T |
|
| Q |
101 |
nnnnntaaccatgattaaaaacaaatgaatataaatagcaacatagcttgcaccggatgttgcatgcagttcttaccaactgggcttcaaatttgcagca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40112024 |
aaaaataaccatgattaaaaacaaatgaatataaatagcaacatagcttgcaccggatgttgcatgcagttcttaccaactgggcttcaaatttgcagca |
40112123 |
T |
|
| Q |
201 |
acgtagaaccaataac |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40112124 |
acgtagaaccaataac |
40112139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 172 - 216
Target Start/End: Original strand, 40149794 - 40149838
Alignment:
| Q |
172 |
cttaccaactgggcttcaaatttgcagcaacgtagaaccaataac |
216 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
40149794 |
cttaccaattgggcttcaaatttgcagccacgtataaccaataac |
40149838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 98
Target Start/End: Complemental strand, 32729359 - 32729307
Alignment:
| Q |
46 |
acgagattagttattgttaaacggtggtggaaacttctaaccaatataatggt |
98 |
Q |
| |
|
||||||||||| |||||||| |||| ||||||||||| |||||||| ||||| |
|
|
| T |
32729359 |
acgagattagtcattgttaagcggttgtggaaacttcataccaatatcatggt |
32729307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University