View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4911-Insertion-8 (Length: 260)
Name: NF4911-Insertion-8
Description: NF4911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4911-Insertion-8 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 8 - 260
Target Start/End: Complemental strand, 32053244 - 32052992
Alignment:
| Q |
8 |
cccgacgcctctcatcggagctagttccaatccgagtccacgacgtgataattcgcggcaacacgaaaaccaaagattgggtgatcgaagctgaactcaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32053244 |
cccgacgcctctcatcggagctagttccaatccgagtccacgacgtgataattcgcggcaacacgaaaaccaaagattgggtgatcgaagctgaactcaa |
32053145 |
T |
 |
| Q |
108 |
gggaatcgaagatgttaccaccatgcaggagcttattcgtgcatcggagattgtgcttgctaggcttcagagtctcggggtttttgaatctagtaagatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32053144 |
gggaatcgaagatgttaccaccatgcaggagcttattcgtgcatcggagattgtgcttgctaggcttcagagtctcggggtttttgaatctagtaagatt |
32053045 |
T |
 |
| Q |
208 |
agtcttgagcctggaccggttgagttgccgaatactgcgaatgttgttgttga |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32053044 |
agtcttgagcctggaccggttgagttgccgaatactgcgaatgttgttgttga |
32052992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 35835234 - 35835148
Alignment:
| Q |
30 |
agttccaatccgagtccacgacgtgataattcgcggcaacacgaaaaccaaagattgggtgatcgaagctgaactcaagggaatcga |
116 |
Q |
| |
|
||||||||| ||||||||||| || | || ||| ||||| ||||||||||||||| | ||||||||||||||| | |||||||| |
|
|
| T |
35835234 |
agttccaattcgagtccacgatgttttcataaccggaaacaccaaaaccaaagattggataatcgaagctgaactcgatggaatcga |
35835148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University