View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4911_high_8 (Length: 258)
Name: NF4911_high_8
Description: NF4911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4911_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 241
Target Start/End: Original strand, 44651422 - 44651652
Alignment:
| Q |
11 |
agaatatgaagtgtttataaacaatttagtgcattatatattctacaaataatgatctcctttgggtaaaaccattttttctcaatttttgtatatacct |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44651422 |
agaatatgaagtgtttataaacaatttagtgcattatatattctacaaataatgatctcctttgggtaaaagcattttttctcaatttttgtatatacct |
44651521 |
T |
 |
| Q |
111 |
acggcaaaacaacaatcaaactgatatgatttatcaacaaaactgcataatattaataacatcatgatccatagtaggctgatgacgacggccggagcta |
210 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44651522 |
accgcaaaacaacaatcaaactgatatgatttatcaacaaaactgcataatattaataacatcatgatccatagtaggctgatgacgacggccggagcta |
44651621 |
T |
 |
| Q |
211 |
gttggttacagcggaagatggcattgctact |
241 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |
|
|
| T |
44651622 |
gttggttacggcggaagatggcattgctact |
44651652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University