View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4911_high_9 (Length: 251)
Name: NF4911_high_9
Description: NF4911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4911_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 31860889 - 31861130
Alignment:
| Q |
1 |
cacaaatgggacagttttaaatgcagtttttctagactagttttgttggtcataccacagcctgtgtcatcaacttcaaaccaaagtatcattttgttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31860889 |
cacaaatgggacagttttaaatgcagtttttctagactagttttgttggtcataccacagcctgtgtcatcaacttcaaaccaaagtatcattttgttat |
31860988 |
T |
 |
| Q |
101 |
caatattagaagccttctttgaatggttctcatgctgcttcattttggtcttccgagaacatccaaatggcttctgctccagggtaaaattttcactatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31860989 |
caatattagaagccttctttgaatggttctcatgctgcttcattttggtcttccgagaacatccgaatggcttctgctccagggtaaaattttcactatc |
31861088 |
T |
 |
| Q |
201 |
accgtaagaatttggattttcacaccatcctctcagaataat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31861089 |
accgtaagaatttggattttcacaccatcctctcagaataat |
31861130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 51 - 101
Target Start/End: Complemental strand, 8868366 - 8868316
Alignment:
| Q |
51 |
cataccacagcctgtgtcatcaacttcaaaccaaagtatcattttgttatc |
101 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
8868366 |
cataccacagcctgtgtcctcaacttcaaaccaaagtatcactttgttatc |
8868316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University