View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4911_low_11 (Length: 248)

Name: NF4911_low_11
Description: NF4911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4911_low_11
NF4911_low_11
[»] chr2 (1 HSPs)
chr2 (19-169)||(45559724-45559874)


Alignment Details
Target: chr2 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 19 - 169
Target Start/End: Original strand, 45559724 - 45559874
Alignment:
19 aacccttccactcaccgtgtagtctctctcaacctttcctcttttaacattcatgctccattacgacctgaaatttctaattgcacacacctcaactatt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
45559724 aacccttccactcaccgtgtagtctctctcaacctttcctcttgtaacattcatgctccattacgacctgaaatttctaattgcacacacctcaactact 45559823  T
119 tagacctttcttctaattactttaccggccaaatacctcactcattctcta 169  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||    
45559824 tagacctttcttctaattactttaccggtcaaatacctcactcattctcta 45559874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University