View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4911_low_11 (Length: 248)
Name: NF4911_low_11
Description: NF4911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4911_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 19 - 169
Target Start/End: Original strand, 45559724 - 45559874
Alignment:
| Q |
19 |
aacccttccactcaccgtgtagtctctctcaacctttcctcttttaacattcatgctccattacgacctgaaatttctaattgcacacacctcaactatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45559724 |
aacccttccactcaccgtgtagtctctctcaacctttcctcttgtaacattcatgctccattacgacctgaaatttctaattgcacacacctcaactact |
45559823 |
T |
 |
| Q |
119 |
tagacctttcttctaattactttaccggccaaatacctcactcattctcta |
169 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45559824 |
tagacctttcttctaattactttaccggtcaaatacctcactcattctcta |
45559874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University