View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4911_low_13 (Length: 214)
Name: NF4911_low_13
Description: NF4911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4911_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 1324802 - 1324596
Alignment:
| Q |
1 |
aaataatggtacaaagtaagaaaaggtgaagggtaaatttcaaaaaccgtaaacc-------ctaccacataccaatgtaaattgcgaatcatgtgaata |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1324802 |
aaataatggtacaaagtaagaaaaggtgaagggtaaatttcaaaaaccgtaaacctgcacccctaccacataccaatgtaaattgcgaatcatgtgaata |
1324703 |
T |
 |
| Q |
94 |
tgatcttagttggtatgtggtacggctgcgggtttatggtacgtgatatgagaagaatttgatatgtatgcacgtatattatatatagctttagtacatg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
1324702 |
tgatcttagttggtatgtggtacggctgcgggtttatggtacgcgatatgagaagaatttgatatgtatgcacgtatattatatatagcttcagtacgtg |
1324603 |
T |
 |
| Q |
194 |
ttgtttt |
200 |
Q |
| |
|
||||||| |
|
|
| T |
1324602 |
ttgtttt |
1324596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University