View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4911_low_13 (Length: 214)

Name: NF4911_low_13
Description: NF4911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4911_low_13
NF4911_low_13
[»] chr2 (1 HSPs)
chr2 (1-200)||(1324596-1324802)


Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 1324802 - 1324596
Alignment:
1 aaataatggtacaaagtaagaaaaggtgaagggtaaatttcaaaaaccgtaaacc-------ctaccacataccaatgtaaattgcgaatcatgtgaata 93  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||    
1324802 aaataatggtacaaagtaagaaaaggtgaagggtaaatttcaaaaaccgtaaacctgcacccctaccacataccaatgtaaattgcgaatcatgtgaata 1324703  T
94 tgatcttagttggtatgtggtacggctgcgggtttatggtacgtgatatgagaagaatttgatatgtatgcacgtatattatatatagctttagtacatg 193  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||    
1324702 tgatcttagttggtatgtggtacggctgcgggtttatggtacgcgatatgagaagaatttgatatgtatgcacgtatattatatatagcttcagtacgtg 1324603  T
194 ttgtttt 200  Q
    |||||||    
1324602 ttgtttt 1324596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University