View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4911_low_7 (Length: 294)
Name: NF4911_low_7
Description: NF4911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4911_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 65 - 154
Target Start/End: Complemental strand, 6451351 - 6451263
Alignment:
| Q |
65 |
tcaaccattaaccaatgtcatacataactatatatttttctttttaattcacacatgcatataaagtgttgagaagtcaagaattgtgaa |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
6451351 |
tcaaccattaaccaatgtcatacataactatatatttttc-ttttaattcacacatatatataaagttttgagaagtcaagaattgtgaa |
6451263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 233 - 276
Target Start/End: Complemental strand, 6451262 - 6451219
Alignment:
| Q |
233 |
tttatcatgagataaatctaaataaaattttggatgttggattt |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6451262 |
tttatcatgagataaatctaaataaaattttggatgctggattt |
6451219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University