View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4912-Insertion-5 (Length: 225)
Name: NF4912-Insertion-5
Description: NF4912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4912-Insertion-5 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 91 - 225
Target Start/End: Original strand, 40193084 - 40193218
Alignment:
| Q |
91 |
atatcacgtccttagtcttactaaaagctaaatgaatattagcacttttttgataaatcgatttatttttgacaaatttttgataaatcgattgtcaatt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40193084 |
atatcacgtccttagtcttactaaaagctaaatgaatattagcacttttttgataaatcgatttttttttgacaaatttttgataaatcgattgtcaatt |
40193183 |
T |
|
| Q |
191 |
agattataaactaatcctatgagataactgataag |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40193184 |
agattataaactaatcctatgagataactgataag |
40193218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 8 - 109
Target Start/End: Original strand, 40192843 - 40192944
Alignment:
| Q |
8 |
atgaagaaagaaacaaaaatgtaccgataactctactgcattttattttgagcgtagaggattcggttcctgcttggcgaagaatatcacgtccttagtc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40192843 |
atgaagaaagaaacaaaaatgtaccgataactctactgcattttattttgagcgtagaggattcggttcctgcttggagaagaatatcacgtccttagtc |
40192942 |
T |
|
| Q |
108 |
tt |
109 |
Q |
| |
|
|| |
|
|
| T |
40192943 |
tt |
40192944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University