View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4912-Insertion-7 (Length: 151)
Name: NF4912-Insertion-7
Description: NF4912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4912-Insertion-7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 1e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 43 - 150
Target Start/End: Complemental strand, 56222443 - 56222336
Alignment:
| Q |
43 |
ttattattatttcaactctcaactgctaacacaccaactttctttttcatcatttattattactctaccatcatttatgaccacgatgctacacacgttc |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56222443 |
ttattattatttcaactctcaactgctaacacaccaactttctttttcatcatttattattactctaccatcatttatgaccacgatgctacacacgttc |
56222344 |
T |
|
| Q |
143 |
gttcacac |
150 |
Q |
| |
|
|||||||| |
|
|
| T |
56222343 |
gttcacac |
56222336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 11 - 53
Target Start/End: Complemental strand, 56222487 - 56222445
Alignment:
| Q |
11 |
actatagacagtataataatattagtacatacttattattatt |
53 |
Q |
| |
|
|||||||||||||||||| || || |||||||||||||||||| |
|
|
| T |
56222487 |
actatagacagtataatagtactactacatacttattattatt |
56222445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University