View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4912_low_2 (Length: 220)
Name: NF4912_low_2
Description: NF4912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4912_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 52165389 - 52165193
Alignment:
| Q |
1 |
cgaattttgccagtgcttcgatgtcatggtggacgtcaaggaggccgccggagttgctgcgataaacgatttcatcgagggagtaggattcaggggagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52165389 |
cgaattttgccagtgcttcgatgtcatggtggacgtcaaggaggccgccggagttgctgcgataaacgatttcatcgagggagtaggattcaggggagtc |
52165290 |
T |
 |
| Q |
101 |
gaaggtggagttgaatgggacgtatttggcagtgaagttgttgacggtggcagggtgacggcgggcgatgtctttgatgttgtcgatggcgagatcc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52165289 |
gaaggtggagttgaatgggacgtatttggcagtgaagttgttggaggtggcagggtgacggcgggcgatgtctttgatgttgtcggtggcgagatcc |
52165193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 125 - 185
Target Start/End: Original strand, 19437775 - 19437835
Alignment:
| Q |
125 |
tttggcagtgaagttgttgacggtggcagggtgacggcgggcgatgtctttgatgttgtcg |
185 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||| || ||||||||||||||||| |
|
|
| T |
19437775 |
tttggcagtgaagttgttggtggtgaaagggtgacggcgagcattgtctttgatgttgtcg |
19437835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 125 - 185
Target Start/End: Original strand, 19573924 - 19573984
Alignment:
| Q |
125 |
tttggcagtgaagttgttgacggtggcagggtgacggcgggcgatgtctttgatgttgtcg |
185 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||| || ||||||||||||||||| |
|
|
| T |
19573924 |
tttggcagtgaagttgttggtggtgaaagggtgacggcgagcattgtctttgatgttgtcg |
19573984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University