View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4912_low_2 (Length: 220)

Name: NF4912_low_2
Description: NF4912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4912_low_2
NF4912_low_2
[»] chr4 (1 HSPs)
chr4 (1-197)||(52165193-52165389)
[»] chr8 (2 HSPs)
chr8 (125-185)||(19437775-19437835)
chr8 (125-185)||(19573924-19573984)


Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 52165389 - 52165193
Alignment:
1 cgaattttgccagtgcttcgatgtcatggtggacgtcaaggaggccgccggagttgctgcgataaacgatttcatcgagggagtaggattcaggggagtc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52165389 cgaattttgccagtgcttcgatgtcatggtggacgtcaaggaggccgccggagttgctgcgataaacgatttcatcgagggagtaggattcaggggagtc 52165290  T
101 gaaggtggagttgaatgggacgtatttggcagtgaagttgttgacggtggcagggtgacggcgggcgatgtctttgatgttgtcgatggcgagatcc 197  Q
    |||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||| |||||||||||    
52165289 gaaggtggagttgaatgggacgtatttggcagtgaagttgttggaggtggcagggtgacggcgggcgatgtctttgatgttgtcggtggcgagatcc 52165193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 125 - 185
Target Start/End: Original strand, 19437775 - 19437835
Alignment:
125 tttggcagtgaagttgttgacggtggcagggtgacggcgggcgatgtctttgatgttgtcg 185  Q
    |||||||||||||||||||  ||||  |||||||||||| ||  |||||||||||||||||    
19437775 tttggcagtgaagttgttggtggtgaaagggtgacggcgagcattgtctttgatgttgtcg 19437835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 125 - 185
Target Start/End: Original strand, 19573924 - 19573984
Alignment:
125 tttggcagtgaagttgttgacggtggcagggtgacggcgggcgatgtctttgatgttgtcg 185  Q
    |||||||||||||||||||  ||||  |||||||||||| ||  |||||||||||||||||    
19573924 tttggcagtgaagttgttggtggtgaaagggtgacggcgagcattgtctttgatgttgtcg 19573984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University