View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4912_low_3 (Length: 203)
Name: NF4912_low_3
Description: NF4912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4912_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 18 - 156
Target Start/End: Complemental strand, 37492967 - 37492829
Alignment:
| Q |
18 |
aaattcagcatttttggggtgccaaccaaaagctttaatctaatgcaaccaagtttccagattctgaaacaactcatgcatatgcttttttgatatagtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492967 |
aaattcagcatttttggggtgccaaccaaaagctttaatctaatgcaaccaagtttccagattctgaaacaactcatgcatatgcttttttgatatagtt |
37492868 |
T |
 |
| Q |
118 |
ttatttcttgtccctgcttttctcattttacatctttaa |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492867 |
ttatttcttgtccctgcttttctcattttacatctttaa |
37492829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University