View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4913-Insertion-10 (Length: 224)
Name: NF4913-Insertion-10
Description: NF4913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4913-Insertion-10 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 6 - 224
Target Start/End: Complemental strand, 32875176 - 32874958
Alignment:
| Q |
6 |
cattaacaatcttagagtcacannnnnnncatttaaaatatttcttaataactatacttaccattgtgtagaaagtcctgagatcatcaccaccaacatt |
105 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32875176 |
cattaacaatcttagagtcacatttttttcatttaaaatatttcttaataactatacttaccattgtgtagaaagtcctgagatcatcaccaccaacatt |
32875077 |
T |
 |
| Q |
106 |
aacccttggacgattaactagttgagagggtttcattatacatccattgctaatctctctgttgttgatgagagcactcaaagatacagaatttgtaaaa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32875076 |
aacccttggacgattaactagttgagagggtttcattatacatccattgctaatctctctgttattgatgagagcactcaaagatacagaatttgtaaaa |
32874977 |
T |
 |
| Q |
206 |
gggctcaaaacatctccta |
224 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
32874976 |
gggctcaaaacatctccta |
32874958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University