View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4913_low_10 (Length: 243)
Name: NF4913_low_10
Description: NF4913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4913_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 26813093 - 26813322
Alignment:
| Q |
1 |
tttaaaccttatatttcagttttttcttggaataccaatgagtacccaaaggacttgtttcctctcaaattttgaagcctccttatgaatgcgatagtaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26813093 |
tttaaaccttatatttcagttttttcttggaataccaatga--acccaaaggacttgtttcctctcaaattttgaagcctccttatgaatgcgatagtaa |
26813190 |
T |
|
| Q |
101 |
atattggactgaaataatgggtccttgcaatggcatattctgtcttagaggatatcaaaataatgtaatgatgaatccttccttgagacagtttatgtct |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26813191 |
atattggactgtaataatgggtccttgcaatggcatattctgtcttagaggatatcaaaataatgtaatgatgaatccttccttgagacagtttatgtct |
26813290 |
T |
|
| Q |
201 |
ttgcctcaatcccattttacagtttctgatga |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26813291 |
ttgcctcaatcccattttacagtttctgatga |
26813322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University