View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4913_low_12 (Length: 207)
Name: NF4913_low_12
Description: NF4913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4913_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 8e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 16 - 131
Target Start/End: Original strand, 43082645 - 43082760
Alignment:
| Q |
16 |
tcagttccggtcatggttgttgtgactaattttatgagcatcttgtgcattctgtcaatccgttaacaaatggctatacctcgatctgtcgcaaacagac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43082645 |
tcagttccggtcatggttgttgtgactaattttatgagcatcttgtgcattctgtcaatccgttaacaaaaggctatacctcgatctgtcgcaaacagac |
43082744 |
T |
 |
| Q |
116 |
aggcagcaactctaat |
131 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
43082745 |
aggcagcaactctaat |
43082760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 152 - 198
Target Start/End: Original strand, 43082759 - 43082805
Alignment:
| Q |
152 |
atgttcttggccatcgaatgtgatgagttcaaaacctgtgtaatata |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43082759 |
atgttcttggccatcgaatgtgatgagttcaaaacctgtgtaatata |
43082805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University