View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4913_low_4 (Length: 415)
Name: NF4913_low_4
Description: NF4913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4913_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 2e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 2e-84
Query Start/End: Original strand, 16 - 182
Target Start/End: Complemental strand, 24401351 - 24401185
Alignment:
| Q |
16 |
atacttgcagaattgcatcattgaaagtaacactgcctgatgatgtttcagatatcattctgttctgcagtgttttgtttttggtgaaaacatagagggc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24401351 |
atacttgcagaattgcatcattgaaagtaacactgcctgatgatgtttcagatatcattctgttctgcagtgttttgtttttggtgaaaacataaagggc |
24401252 |
T |
|
| Q |
116 |
aagaggcttaggcctagagcttatgaactcaatactgtcctcaatcttatccacctgcaaattatgc |
182 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24401251 |
aagaggcttaggcctagagcttatgaattcaatactgtcctcaatcttatccacctgcaaattatgc |
24401185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 231 - 399
Target Start/End: Complemental strand, 24401136 - 24400968
Alignment:
| Q |
231 |
gatagatataagcatgtggcaaaactaagtcgtaagagtttgattttgtaacgtcaagattcgtaccagacatttgtaaaatagtaactagtgtcgtcat |
330 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24401136 |
gatagataaaagcatgtggtaaaactaagtcgtaagagtttgattttgtaacgtcaagattcgtaccagacatttgtaaaatagtcactagtgtcgtcat |
24401037 |
T |
|
| Q |
331 |
ttaaaaatcacgtggtaagtctagaggctattttatgcaatgaaacttacagtaataattggaagtaat |
399 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24401036 |
ttaaaaatcatgtggtaagtctagaggctattttatgcaatgaaacttacagtaataattggaagtaat |
24400968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 54 - 177
Target Start/End: Complemental strand, 41845708 - 41845585
Alignment:
| Q |
54 |
gatgatgtttcagatatcattctgttctgcagtgttttgtttttggtgaaaacatagagggcaagaggcttaggcctagagcttatgaactcaatactgt |
153 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||| ||||| || ||||| |||| | || ||||| |||||| | ||| ||||||||||||||| || |
|
|
| T |
41845708 |
gatgatgtttcagataccaatcttctctgcagtgtattgttctttgtgaaggcataaattgctagaggtttaggctttgagtttatgaactcaataccgt |
41845609 |
T |
|
| Q |
154 |
cctcaatcttatccacctgcaaat |
177 |
Q |
| |
|
| |||||||| ||||||||||||| |
|
|
| T |
41845608 |
cttcaatcttctccacctgcaaat |
41845585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University