View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4913_low_6 (Length: 344)
Name: NF4913_low_6
Description: NF4913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4913_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 144 - 328
Target Start/End: Original strand, 21441958 - 21442142
Alignment:
| Q |
144 |
agcgacatgtgtcgttgagagaaatacaaagttgttgcgctgcatgtttaggtagcccagctgcctaaagagcattaagtttgccttacaattctggaag |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21441958 |
agcgacatgtgtcgttgagagaaatacaaagttgttgcgctgcatgtttaggtagcccagctgcctaaagagcattaagtttgccttacaattctggaag |
21442057 |
T |
|
| Q |
244 |
cagacaaccatatccataaaggaagcctccacatttagctctatgatgtaactcttggatcaaactcattttaagacatgatgga |
328 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21442058 |
cagacaaccatatccacaaaggaagcctccacatttagctctatgacgtaactcttggatcaaactcattttaagacatgatgga |
21442142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 8 - 57
Target Start/End: Original strand, 21441847 - 21441896
Alignment:
| Q |
8 |
ataaacttatacaggtaagtggaggttctccctctacatctcatttgcct |
57 |
Q |
| |
|
||||||||| ||||| |||||||| |||||| |||||||||||||||||| |
|
|
| T |
21441847 |
ataaacttacacaggcaagtggagattctccttctacatctcatttgcct |
21441896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University