View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4913_low_7 (Length: 284)
Name: NF4913_low_7
Description: NF4913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4913_low_7 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 6 - 284
Target Start/End: Complemental strand, 29632222 - 29631944
Alignment:
| Q |
6 |
atacttaatcataccggtacagtatccaatccaattttgagcagaaacaaaatattcaccaaattcatcattatcattattaccttggtggcagcgaaaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29632222 |
atacttaatcataccggtacagtatccaatccaattttgagcagaaacaaaatattcaccaaattcatcattatcattattaccttagtggcagcgaaaa |
29632123 |
T |
|
| Q |
106 |
taggagcgatttcaggattatcctgaagcaaaactttgagcctctctggagtggcgataacaaggttaggcctggctaccaattgttttgcctgtatacg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29632122 |
taggagcgatttcaggattatcctgaagcaaaattttgagcctctctggagtggcgataacaaggttaggcctggctaccaattgttttgcctgaatacg |
29632023 |
T |
|
| Q |
206 |
tttgtctaaaccacccacaaccaccgtaaggatgaggcggagcgaggacccaaggatccaacactggtgagtcagctga |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
29632022 |
tttgtctaaaccacccacaaccaccgtaaggatgaggcggagcgaggacccaaggatccaaaactggtgagccagctga |
29631944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 62 - 260
Target Start/End: Complemental strand, 29631059 - 29630861
Alignment:
| Q |
62 |
caccaaattcatcattatcattattaccttggtggcagcgaaaataggagcgatttcaggattatcctgaagcaaaactttgagcctctctggagtggcg |
161 |
Q |
| |
|
|||||||||||| | ||||||||||||||| |||| ||||||||||| ||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
29631059 |
caccaaattcatgaatatcattattaccttagtggtagcgaaaatagtagcgatttcaggattatccagaagcaaaactctgagcctctctggagtggcg |
29630960 |
T |
|
| Q |
162 |
ataacaaggttaggcctggctaccaattgttttgcctgtatacgtttgtctaaaccacccacaaccaccgtaaggatgaggcggagcgaggacccaagg |
260 |
Q |
| |
|
|||||||||| ||| ||||||||||||| |||||||||| || | |||| || |||||||||| ||||||||| || || ||||||||||||||||| |
|
|
| T |
29630959 |
ataacaaggtgaggactggctaccaattattttgcctgtgtaggactgtcataatcacccacaacaaccgtaaggctggggaggagcgaggacccaagg |
29630861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University