View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4914_high_5 (Length: 245)
Name: NF4914_high_5
Description: NF4914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4914_high_5 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 245
Target Start/End: Original strand, 40417963 - 40418200
Alignment:
| Q |
18 |
tttctaactcttttcccttggttcgaagagttacaaggagacnnnnnnntttagctcacaatgttctctaagggcatcctctaaatttctctcatttatc |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40417963 |
tttctaactcttttcccttggttcaaagagttacaaggagaccaaaaaatttagctcacaaggttctctaagggcatcctctaaatttctctcatttatc |
40418062 |
T |
|
| Q |
118 |
cttttacgggtcactcaatgattttcaccgtcaagata-----------tttcccaccataagctctgatattaattgttgagaaaaaccggcatagaga |
206 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40418063 |
cttttac-agtcactcaatgattttcactgtcaagatatttaccatgtgtttcccaccataagctctgatattaattgttgagaaaaaccgacatagaga |
40418161 |
T |
|
| Q |
207 |
aaataaagaaacacaattatataagcttcattatatgat |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40418162 |
aaataaagaaacacaattatataagcttcattatatgat |
40418200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University