View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4916-Insertion-6 (Length: 179)
Name: NF4916-Insertion-6
Description: NF4916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4916-Insertion-6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 5e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 5e-67
Query Start/End: Original strand, 8 - 179
Target Start/End: Complemental strand, 979037 - 978863
Alignment:
| Q |
8 |
ggtgctagaatcttttatctcctgggttgttatatgtgtttctttctttcagttgtactctacaagaattattgatttctttatcagagcgtattcacct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
979037 |
ggtgctagaatcttttatctcctgggttcttatatgtgtctctttctttcagttgtactctacaagaattattgatttctttatcataatgtattcacct |
978938 |
T |
 |
| Q |
108 |
tttctttttctatgtgcttttgtctgttaccctacataaac---cttggtttcttctagatttcatctttctcta |
179 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||| |||||||| |
|
|
| T |
978937 |
tttctttttctctgtgcttttgtctgttaccctacagaaaccttcttggtttcttctagatttcatttttctcta |
978863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University