View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4916-Insertion-9 (Length: 247)
Name: NF4916-Insertion-9
Description: NF4916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4916-Insertion-9 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 23 - 247
Target Start/End: Complemental strand, 17538384 - 17538155
Alignment:
| Q |
23 |
attgatgatgcttctttgatttgaattgtctgtttgtctggtctgctcagagattggattggagtatgtcactttcttaatttttgttac-ttggaatgc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17538384 |
attgatgatgcttctttgatttgaattgtctgtttgtctggtctgctgagagattggattggagtatgtcactttcttaatttttgttactttggaatgc |
17538285 |
T |
|
| Q |
122 |
aaattatgttagtgaag----ttactttattttcccttctannnnnnnatgatacttgaaggcagaannnnnnnnnattgcttattagtttcttccaatt |
217 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17538284 |
aaattatgttagtgaagttaattactttattttcccttctatttttttctgatacttgaaggcagaaaaactttttattgcttattagtttcttccaatt |
17538185 |
T |
|
| Q |
218 |
tactttcaaaagcttcaaatcattttattt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17538184 |
tactttcaaaagcttcaaatcattttattt |
17538155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 92 - 158
Target Start/End: Original strand, 17694259 - 17694325
Alignment:
| Q |
92 |
cactttcttaatttttgttacttggaatgcaaattatgttagtgaagttactttattttcccttcta |
158 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17694259 |
cactttcttaatttttgttttttggaatgcaaattatgttagtgaagttactttattttcccttcta |
17694325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University