View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4916_high_8 (Length: 285)
Name: NF4916_high_8
Description: NF4916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4916_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 14 - 267
Target Start/End: Complemental strand, 40937635 - 40937380
Alignment:
| Q |
14 |
agagaatatgaaaaatgttgcaagctagctatgcatggttttattttgttata--gtttatcttaattactatcataataatactagatagcgctactac |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40937635 |
agagaatatgaaaaatgttgcaagctagctatgcatggttttattttgttatatagtttatcttaattactatcataataatactagatagcgctactac |
40937536 |
T |
|
| Q |
112 |
tagagtatttctaaataaattaacacgatgctttgatctgtgtttgagtttatgataactatactttggctattgaactcatcttgttgggcggctgaaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40937535 |
tagagtatttctaaataaattaacacgatgctttgatctgtgtttgagtttatgataactatactttgactattgaactcatcttgttgggcggctgaaa |
40937436 |
T |
|
| Q |
212 |
attgattgaatctctcaattctaaatatttctaatccggttctcatgtgattgcac |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40937435 |
attgattgaatctctcaattctaaatatttctaatccggttctcatgtgattgcac |
40937380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University