View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4916_low_12 (Length: 217)
Name: NF4916_low_12
Description: NF4916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4916_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 17 - 199
Target Start/End: Original strand, 12868495 - 12868677
Alignment:
| Q |
17 |
aatatcttgaagcaacccattatctcttaacaaagcctcattaacaaaccctgaagatccaaaacctcgatgattaatcacttggtcattcacaaaacca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12868495 |
aatatcttgaagcaacccattatctcttaacaaagcctcattaacaaaccctgaagatccaaaacctcgatgattaatcacttggtcattcgcaaaacca |
12868594 |
T |
 |
| Q |
117 |
ccaaacgacgacgtgttaacataactaccactagaaccaccaacataattagaagaagggggtgtagtagtagtagtaatatt |
199 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12868595 |
ccaaacgacgacgtgttaacacaactaccaccagaaccaccaacataattagaagaagggggtgtagtagtagtagtaatatt |
12868677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University