View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4917_low_4 (Length: 238)
Name: NF4917_low_4
Description: NF4917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4917_low_4 |
 | |
|
| [»] scaffold0126 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0126 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 10 - 223
Target Start/End: Complemental strand, 27347 - 27134
Alignment:
| Q |
10 |
gtttgatctcagaaacaaatattcaagtgcttatgatttaggtgaattggatcaagcannnnnnnngtatctagatggacaagcacaagctgatccttct |
109 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27347 |
gtttgatctcagaaacaaagattcaagtgcttatgatttaggtgaattggatcaagcattttttttgtatctagatggacaagcacaagctgatccttct |
27248 |
T |
|
| Q |
110 |
aatgttccagatcaaagacgtgagcactctctctagctctctctgtatgaaagagaaattcacaaataaaaataaaatatctttctgttttcagtattaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| ||||| |||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27247 |
aatgttccagatcaaagacgtgagcactctctctaactctctctgtgtgaaaaagaatttcacaaataaaaataaaatatatttctgttttcagtattaa |
27148 |
T |
|
| Q |
210 |
tttttggtcaaatt |
223 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
27147 |
tttttggtcaaatt |
27134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University